View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6422_high_5 (Length: 268)
Name: NF6422_high_5
Description: NF6422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6422_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 95 - 230
Target Start/End: Complemental strand, 28237750 - 28237615
Alignment:
| Q |
95 |
tcttgatactcctcaaagtattgaagatcgtgtggtttcttatttctttaatctatttgctttggttccgatggtgttgatttgaaccatgatgtatact |
194 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||| |||||| | ||||||||||||||||||||| ||| |||| |||||||||| | ||||||| |
|
|
| T |
28237750 |
tcttgatactccttaaaatattgaagatcgtgtgattttttatttgtctaatctatttgctttggttccagtggcgttggtttgaaccataaagtatact |
28237651 |
T |
|
| Q |
195 |
tttctccatcgtttcaggttcgaacatcttcgatat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
28237650 |
tttctccatcgtttcaggttcgaacatcttcaatat |
28237615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 28237965 - 28237882
Alignment:
| Q |
19 |
attcagcaaatataagatcataattattctcacaaatttgatgttg----aagatgtgtaaaaattgatcttgaaaagactctt |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||| |||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
28237965 |
attcaacaaatataagatcataattattctgacaaccttgacgttgaagaaagacttgttgaaattgatcttgaaaagactctt |
28237882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University