View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6422_low_4 (Length: 314)
Name: NF6422_low_4
Description: NF6422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6422_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 18 - 146
Target Start/End: Original strand, 26017052 - 26017180
Alignment:
| Q |
18 |
aggagatgggttttctgtgtattgtaagagaggaagcaggaagcatatggaggatcgttactctgcttctcttgatcttcatggacaatctaaacaggta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26017052 |
aggagatgggttttctgtgtattgtaagagaggaagcaggaagcatatggaggatcgttactctgcttctcttgatcttcatggacaatctaaacaggta |
26017151 |
T |
|
| Q |
118 |
acttcatgggttgcatggatttgttcatc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26017152 |
acttcatgggttgcatggatttgttcatc |
26017180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 123
Target Start/End: Original strand, 26002010 - 26002114
Alignment:
| Q |
19 |
ggagatgggttttctgtgtattgtaagagaggaagcaggaagcatatggaggatcgttactctgcttctcttgatcttcatggacaatctaaacaggtaa |
118 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||| | || || ||||||||||||||||| ||||||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
26002010 |
ggagatggattttctgtgtattgtaagaaaggaggtagaaaacatatggaggatcgttattctgcttctgttgatcttcatggtgaatcaaaacaggtaa |
26002109 |
T |
|
| Q |
119 |
cttca |
123 |
Q |
| |
|
||||| |
|
|
| T |
26002110 |
cttca |
26002114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 30373249 - 30373307
Alignment:
| Q |
19 |
ggagatgggttttctgtgtattgtaagagaggaagcaggaagcatatggaggatcgtta |
77 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| || ||| || ||||||| |||||||| |
|
|
| T |
30373249 |
ggagatgggtattctgtttattgtaagagagggaggagggagtatatggaagatcgtta |
30373307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University