View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6423_high_4 (Length: 325)
Name: NF6423_high_4
Description: NF6423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6423_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 70 - 318
Target Start/End: Original strand, 41004616 - 41004864
Alignment:
| Q |
70 |
ttcgcaccgtcgttgaaaacggtacctcacgtttcatctccttcgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41004616 |
ttcgcaccgtcgttgaaaacggtacctcacgtttcatctcctttgtcgacggcgatccctccgttaaatctctactttcccgtcttgaccttgccggtaa |
41004715 |
T |
 |
| Q |
170 |
cgccgttaacgctgctaattatcaacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttctgcatctcact |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41004716 |
cgccgttaacgctgctaattatcaacaccgtcaacgttcttctcagtttcatccttctccagctgctcttcgccgtcgtcgtccttttcttcatctcact |
41004815 |
T |
 |
| Q |
270 |
cgtgtcggaaccctagatgatgatttcttctccggtgatgatgatgatg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41004816 |
cgtgtcggaaccctagatgatgatttcttctccggtgatgatgatgatg |
41004864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University