View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6424_high_7 (Length: 214)
Name: NF6424_high_7
Description: NF6424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6424_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 97 - 198
Target Start/End: Original strand, 341831 - 341932
Alignment:
| Q |
97 |
tccaatagcttgaaaatgagatgtcttcggtgcattttttaaaatagggcaaccaagataagttagtggaatatcactcgtactaaaatccaacaaagca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
341831 |
tccaatagcttgaaaatgagatgtcttcggtgcattttttaaaatagggcaaccaagataagtaagtggaatatcacttgtactaaaatccaacaaagca |
341930 |
T |
 |
| Q |
197 |
ac |
198 |
Q |
| |
|
|| |
|
|
| T |
341931 |
ac |
341932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University