View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6425_low_15 (Length: 210)
Name: NF6425_low_15
Description: NF6425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6425_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 195
Target Start/End: Complemental strand, 18255823 - 18255642
Alignment:
| Q |
14 |
atcatgtggtaaaaacgggccgaatcctgcaatgtccatagtatgtataaggttaaattccttttttatatccaattgttctaatagtttaggttgttta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
18255823 |
atcatgtggtaaaaacgggccgaatcctgcaatgtccatagtatgtataagcttaaattccttttttagatgcaattgttctaatagtttaggttgttta |
18255724 |
T |
 |
| Q |
114 |
tgcaaaagttgtttaggatgaagcataaatctgctgaaagaatctatggacatattctactatgtgctgaaagactgaaatt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18255723 |
tgcaaaagttgtttaggatgaagcataaatctgctgaaagaatctatggacatattctactatgtgctgaaagactgaaatt |
18255642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University