View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6426_high_6 (Length: 248)
Name: NF6426_high_6
Description: NF6426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6426_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 27664689 - 27664929
Alignment:
| Q |
1 |
gtttgggataaccagttcgtaaaagtatcatgaactggttcatgcaaaccggtttgcggttccctgggtcaatagggaattctataactatgaactagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27664689 |
gtttgggataaccagttcgtaaaagtatcatgaactggttcatgcaaaccggtttgcggttccctgggtcaatagggaattctataactatgaactagtt |
27664788 |
T |
 |
| Q |
101 |
agacaagagatgaaataacattctagagcttgtattttagtaattgttaaataatatcagctatgaaaattagtttttgcaaataatatgcacaacgatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27664789 |
ggacaagagatgaaataacattctagagcttgtattttagtaattgtcaaataatatcagctatgaaaattagtttttgcaaataatatgcacaacgatc |
27664888 |
T |
 |
| Q |
201 |
ctaaccattgaacatggatttttagttttatgtgacctttg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27664889 |
ctaaccattgaacatggatttttagttttatgtgacctttg |
27664929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 236
Target Start/End: Original strand, 27644050 - 27644185
Alignment:
| Q |
101 |
agacaagagatgaaataacattctagagcttgtattttagtaattgttaaataatatcagctatgaaaattagtttttgcaaataatatgcacaacgatc |
200 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||| | |||| |||||||| || |||||||| ||||||||||| |||||| |||| |
|
|
| T |
27644050 |
agacaagagatgaaataagattttagagcttgtaatttagtaattgtcacataagatcagctaggagcattagtttgtgcaaataatacgcacaaggatc |
27644149 |
T |
 |
| Q |
201 |
ctaaccattgaacatggatttttagttttatgtgac |
236 |
Q |
| |
|
|| | |||||||||||||||||||||||| |||||| |
|
|
| T |
27644150 |
ctgatcattgaacatggatttttagttttctgtgac |
27644185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University