View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6426_high_8 (Length: 229)
Name: NF6426_high_8
Description: NF6426
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6426_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 212
Target Start/End: Original strand, 43327361 - 43327549
Alignment:
| Q |
19 |
tattattaatcttcttatgaacatgttgagggagaactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43327361 |
tattattaatcttcttatgaacatgttgagggaggactatcacggcttcaaatccttggcttacaaagacagaagctagattttgcatgggactaacatg |
43327460 |
T |
|
| Q |
119 |
tccttgtgcgggatagggaacaaaaacgattattggcttcttcatgttcataattaattagttacgttggttactttccaattcttctaagcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43327461 |
tccttgtgcgggatagggaacaaaaacgattattggcttcttcatgttcataattaatta-----gttggttactttccaattcttctaagcaa |
43327549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University