View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6427_high_1 (Length: 237)
Name: NF6427_high_1
Description: NF6427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6427_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 24 - 215
Target Start/End: Original strand, 38743845 - 38744035
Alignment:
| Q |
24 |
tttttgagaatgaagtgaagtaaacacactaccgtgtgttattatatagtgtaggtgatggggtgtttgtttaagattcagatattttagacggtttaga |
123 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38743845 |
tttttgaatatgaagtgaagtaaacacactaccgtgtattattatatag-gtagttgatggggtgtttgtttgagattcagatattttagacggtttaga |
38743943 |
T |
 |
| Q |
124 |
nnnnnnnagaaggtaacttggacattgttattgtgattgagcggttgagattttctctttggttgttatattttttgaaaaaatatttggtt |
215 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38743944 |
tttttttagaaggtaacttgtacattgttattgtgattgaacggttgagattttctctttggttgttatattttttgaaaaaatctttggtt |
38744035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 38788575 - 38788383
Alignment:
| Q |
16 |
atgaaccgtttttgagaatgaagtgaagtaaacacactaccgtgtgttattatatagtgtaggtgatggggtgtttgtttaagattcagatattttagac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
38788575 |
atgaaccgtttttgagaatgaagtgaagtaaacacactaccgtgtgttattatatagtgtaggtgatggggtatttgttttagattcagatattttagat |
38788476 |
T |
 |
| Q |
116 |
ggtttagannnnnnnagaaggtaacttggacattgttattgtgattgagcggttgagattttctctttggttgttatattttttgaaaaaatatttggtt |
215 |
Q |
| |
|
||||||| ||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
38788475 |
tgtttagatttttttagaaggtaacttgtacattgtt-------ttagacggttgagattttctctttggttgttatattttttgacaaaatctttggtt |
38788383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 123
Target Start/End: Complemental strand, 38782364 - 38782302
Alignment:
| Q |
61 |
gttattatatagtgtaggtgatggggtgtttgtttaagattcagatattttagacggtttaga |
123 |
Q |
| |
|
|||||||||||||||||| ||| | | ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
38782364 |
gttattatatagtgtaggcgattgtatatttgtttgagattgggatattttagacggtttaga |
38782302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University