View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6428_high_7 (Length: 411)

Name: NF6428_high_7
Description: NF6428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6428_high_7
NF6428_high_7
[»] scaffold0008 (2 HSPs)
scaffold0008 (41-179)||(52644-52782)
scaffold0008 (245-379)||(52882-53008)


Alignment Details
Target: scaffold0008 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 41 - 179
Target Start/End: Original strand, 52644 - 52782
Alignment:
41 gtcaaggtaattgaaataaaccctaaaccctaaagaacacatgcagtattcaagtaataatttatgaacactaaaccctaaagaaccaatgtaataaacc 140  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||||||||||||    
52644 gtcaaggtaattgaaataaaccctaaaccctaaagaacccatgcagtact-aagtaataatttatgaacactaaaccttaaagaaccaatgtaataaacc 52742  T
141 ctaaaccgt-aagaacccatgtagtactcaagtaatttat 179  Q
    ||||||| | |||||||||||||||||||||||| |||||    
52743 ctaaaccctaaagaacccatgtagtactcaagtagtttat 52782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 245 - 379
Target Start/End: Original strand, 52882 - 53008
Alignment:
245 atgatcttaattcattatacataaataaacacatagtgctaatgattgatttgttcttgtnnnnnnnntcgatttcttcacataaccggtttgtaatgaa 344  Q
    |||||||||||||||||||||||||    ||||||||||||||    |||||||||||||        ||||||||||||||||| || |||||||||||    
52882 atgatcttaattcattatacataaa----cacatagtgctaata---gatttgttcttgtaaaaaaa-tcgatttcttcacataaacgatttgtaatgaa 52973  T
345 actcacgataaatcaagcagaaaaacaatatacca 379  Q
    |||||||||||||| ||||||||||||||||||||    
52974 actcacgataaatcgagcagaaaaacaatatacca 53008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University