View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6428_low_15 (Length: 229)
Name: NF6428_low_15
Description: NF6428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6428_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 229
Target Start/End: Original strand, 41089772 - 41089996
Alignment:
| Q |
5 |
caaataaaagtaaattctcttatgaacacaaaattgggttgaataagatgcatacagaaaatcatagttaatgaaaagtcaacaacttcaatccagaaaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41089772 |
caaataaaagtaaattctcttatgaacacaaaattgggttgaataagatgcatacagaaaatcatagttaatgaaaagtcaacaacttcaatccagaaaa |
41089871 |
T |
 |
| Q |
105 |
tcaaagtcctgctgcatcaaacaaccagaagtacacttaaccaaaacagataatgtcaaatctctacaggttcaaaattgtattttagtaacaaattcat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41089872 |
tcaaagtcctgctgcatcaaacaaccagaagtacaattaaccaaaacagataatgtcaaatctctacaggttcaaaattgtattttagtaacaaattcat |
41089971 |
T |
 |
| Q |
205 |
gatcaaattaaaacacctaatccaa |
229 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
41089972 |
gatcaaattaaaacatctaatccaa |
41089996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University