View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6428_low_3 (Length: 560)
Name: NF6428_low_3
Description: NF6428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6428_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 7e-72; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 358 - 550
Target Start/End: Complemental strand, 33882563 - 33882373
Alignment:
| Q |
358 |
cgtcccaattccccacctattcccattcctttgnnnnnnnnnnnngggtacaaccacttcacctactcatgtcttcccttactaccaacgcagactacaa |
457 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33882563 |
cgtctcaattccccacctattcccattcctttttgttttttttttgggtacaaccacttcacctactcatgtcttcccttactaccaacgcagactacaa |
33882464 |
T |
 |
| Q |
458 |
ctcctctccctctcaatagaaacacaaggtacctctctccatttgcctaagctaattaaccctcaccgaaagccacacatcctttcctctgtg |
550 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33882463 |
ctcctctccctctcaatagaaacacaaggtacc--tctccatttgcctaagctaattaaccctcaccgaaagccacacatcctttcctctgtg |
33882373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 18 - 130
Target Start/End: Complemental strand, 33882938 - 33882829
Alignment:
| Q |
18 |
ggatcaaccgagagttgggatgatcaaaattggaattgaaatcatacaaaacttacttcttttgtaagtttgtcagttgtcactcatcaggaggagatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
33882938 |
ggatcaaccgagagttgggatgatcaaaattggaattgaaatcatacaaaacttacttcttttgtaagtttgtcagttgtcactcatc---atgagatcc |
33882842 |
T |
 |
| Q |
118 |
ttggccatatacg |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33882841 |
ttggccatatacg |
33882829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 229 - 306
Target Start/End: Complemental strand, 33882732 - 33882655
Alignment:
| Q |
229 |
aaattattatagtttcacgatgacacatgatgaattaatgggatttccattatcttattcgtgaagttagatcagttg |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33882732 |
aaattattatagtttcacgatgacacatgatgaattaataggatttccattatcgtattcgtgaagttagattagttg |
33882655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University