View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6428_low_7 (Length: 411)
Name: NF6428_low_7
Description: NF6428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6428_low_7 |
 |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 41 - 179
Target Start/End: Original strand, 52644 - 52782
Alignment:
| Q |
41 |
gtcaaggtaattgaaataaaccctaaaccctaaagaacacatgcagtattcaagtaataatttatgaacactaaaccctaaagaaccaatgtaataaacc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52644 |
gtcaaggtaattgaaataaaccctaaaccctaaagaacccatgcagtact-aagtaataatttatgaacactaaaccttaaagaaccaatgtaataaacc |
52742 |
T |
 |
| Q |
141 |
ctaaaccgt-aagaacccatgtagtactcaagtaatttat |
179 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
52743 |
ctaaaccctaaagaacccatgtagtactcaagtagtttat |
52782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 245 - 379
Target Start/End: Original strand, 52882 - 53008
Alignment:
| Q |
245 |
atgatcttaattcattatacataaataaacacatagtgctaatgattgatttgttcttgtnnnnnnnntcgatttcttcacataaccggtttgtaatgaa |
344 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
52882 |
atgatcttaattcattatacataaa----cacatagtgctaata---gatttgttcttgtaaaaaaa-tcgatttcttcacataaacgatttgtaatgaa |
52973 |
T |
 |
| Q |
345 |
actcacgataaatcaagcagaaaaacaatatacca |
379 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
52974 |
actcacgataaatcgagcagaaaaacaatatacca |
53008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University