View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_high_23 (Length: 326)
Name: NF6429_high_23
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 316
Target Start/End: Complemental strand, 9700065 - 9699768
Alignment:
| Q |
19 |
tcttcactgatgcctatgatctgttctgcatttcaaccgtttcgaagctcttgggacgattatattactttgatccaagcactaacaaaccagggaagct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700065 |
tcttcactgatgcctatgatctgttctgcatttcaaccgtttcgaagctcttgggacgattatattactttgatccaagcactaacaaaccagggaagct |
9699966 |
T |
 |
| Q |
119 |
tccaccaacaattaataacttagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaag |
218 |
Q |
| |
|
||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9699965 |
tccaccatcagttaataatgtagtcaccggtgtggcccttgtcggaacactttctggccaattagtcttcggctggctcggagacaaacttggacgcaag |
9699866 |
T |
 |
| Q |
219 |
aaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccccgaaatctgttatgttaaccctttg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
9699865 |
aaagtttatggtgtcacactcattatcatggttgcttgtgccatttgctctggtctttcttttggttcttccgcgaaatctgttatgataaccctttg |
9699768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University