View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_high_31 (Length: 254)
Name: NF6429_high_31
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 40123471 - 40123230
Alignment:
| Q |
1 |
cggtagttaaccaccttgaagatattttcgaaagtttaaggtgtttgtaagcaattgttaggtgcataaagagcaattttcataggtttttaaacctgta |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40123471 |
cggtagttaaccacgttgaagatattttcgaaagtttaaggggtttgtaagcaattgttaggtgcataaagagcaattttcataggtttttaaacctgta |
40123372 |
T |
 |
| Q |
101 |
atgaaatctatccatttgacnnnnnnnnnnnnngtggtatggagtatttaactttggtttatatatcttgacaaaaataatctttggtttatatacctta |
200 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40123371 |
atgaaatttatccatttgacaaaaaacaaaaaagtggtatggagtatttaactttggtttatatatcttaacaaaaataatctttggtttatatacctta |
40123272 |
T |
 |
| Q |
201 |
-nnnnnnngagggatttatatacttgtttttggtcactagta |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40123271 |
ttttttttgagggatttatatacttgtttttggtcactagta |
40123230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University