View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_high_37 (Length: 244)
Name: NF6429_high_37
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 32437244 - 32437179
Alignment:
| Q |
1 |
ttgataaaactaatcatataattcaatcctgattaaaatgtttgtcatctagttaatgttctattt |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| | || ||||||| ||||||||||| |
|
|
| T |
32437244 |
ttgataaaactaatcatataattcaatcctgattaagatgtgtatcttctagttgatgttctattt |
32437179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University