View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6429_high_44 (Length: 229)

Name: NF6429_high_44
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6429_high_44
NF6429_high_44
[»] chr7 (1 HSPs)
chr7 (95-219)||(33538644-33538764)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 95 - 219
Target Start/End: Original strand, 33538644 - 33538764
Alignment:
95 gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgctagctcattatactgttatgtagacaaataacgacataataggtgaag 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||    
33538644 gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgct----cattatactgttatgtagacaaataacgacataataggtgaag 33538739  T
195 aaaattagtaaggttttgatgatgt 219  Q
    |||||||||||||||||||||||||    
33538740 aaaattagtaaggttttgatgatgt 33538764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University