View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_low_3 (Length: 577)
Name: NF6429_low_3
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-144; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-144
Query Start/End: Original strand, 15 - 294
Target Start/End: Original strand, 34541768 - 34542046
Alignment:
| Q |
15 |
gacgagaattttatcctccggaggaagaggaggagggggagatggtggtagaggtgaacgttgggaagctacggcgccattttggtcggtcgtagggttt |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34541768 |
gacgagaattttatcctccggtggaagaggaggagggggagatggtggtagaggtgaacgttgggaagctacggcgccgttttggtcggtcgtagggttt |
34541867 |
T |
 |
| Q |
115 |
tgctccgtctccattggactaggagaactactactcattttgatgcaactgggtgggtctctgagaacgaaggggggtaagaaaagtggaaaattgattt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34541868 |
tgctccgtctccattggactaggagaactactactcattttgatgcaactgggtgggtctctgagaacgaa-gggggtaagaaaagtggaaaattgattt |
34541966 |
T |
 |
| Q |
215 |
gaatgagggttttcttttaatttcggcgggaaatcaaaatcacaatgcccatcatttgacttctactgctagttgtactt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34541967 |
gaatgagggttttcttttaatttcggcgggaaatcaaaatcacaatgcccatcatttgacttatactgctagttgtactt |
34542046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 337 - 521
Target Start/End: Original strand, 34543277 - 34543456
Alignment:
| Q |
337 |
tgaataattgaattatcgttgaattaatgtgattatgggaaactctctattaaagtatatcactaatttctatttgtctttaccgtgggaccaaggatca |
436 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||| |||||| ||||||||||||||||||||||||| | | |
|
|
| T |
34543277 |
tgaataattgaattatcgttgaattaatgtgattatgagaaagtctctatgaaagtatatcaccaatttcaatttgtctttaccgtgggaccaaggttga |
34543376 |
T |
 |
| Q |
437 |
gactattcttcatgtgattagaggctgtacttatacatacaacttaggtatggaagacttgtactttttttattgtataattgac |
521 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
34543377 |
gactattcttcatgtgattagaggctgtactt----atacaacttagttatggaagacttgtac-tttttgattgtataattgac |
34543456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University