View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_low_36 (Length: 249)
Name: NF6429_low_36
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 237
Target Start/End: Complemental strand, 10794592 - 10794350
Alignment:
| Q |
2 |
acataagtttaagttcagtaatttatatcctcaaattattgtggatttgtttatgtgatcaggtatcaagtactagcaggaattattgagcaacggattc |
101 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10794592 |
acatatgtttaagttcagtaatttatatcctcaaattattgtggatttgtttatgtgatcaggtatcaagtactagcaggaattattgagcaacggattc |
10794493 |
T |
|
| Q |
102 |
tggaaccattgctacgccaaaacaaacttatactaactggagcatactttattgttagaactgctaatacttattggggctccctactgtaa-------g |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10794492 |
tggaaccattgctacgccaaaacaaacttatactaactggagcatactttattgttagaactgctaatacttattggggctccctactgtaagattattg |
10794393 |
T |
|
| Q |
195 |
atttatctcagttaatatttgtaatctaaaagttattatgttc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10794392 |
atttatctcagttaatatttgtaacctaaaagttattatgttc |
10794350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University