View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_low_40 (Length: 244)
Name: NF6429_low_40
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 27873164 - 27873003
Alignment:
| Q |
1 |
tcaattgaagaggacccaccaagcaagtctcttgtaatcatagccgttgatttctcaccatgagaatcattgccaaccgttcgatgttgctcatctttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873164 |
tcaattgaagaggacccaccaagcaagtctcttgtaatcagagccgttgatttctcaccatgagaatcattgccaaccgttcgatgttgctcatctttgt |
27873065 |
T |
|
| Q |
101 |
atccaccaccacctagaaccctaacaagagaactaacttcagtagccattgcttaatttctc |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873064 |
atccaccaccacctagaaccctaacaagagaactaacttcagtagccattgcttaatttctc |
27873003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University