View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_low_44 (Length: 238)
Name: NF6429_low_44
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 83 - 221
Target Start/End: Original strand, 17775551 - 17775689
Alignment:
| Q |
83 |
agaactaaaatcaaaacttcttcacttcatacagaaaaatatatatttaattcttattttttatcaaataagtcaaaattcacgagtttattactgttct |
182 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17775551 |
agaactaaaatcaaaacttattcacttcatacagaaaaatatatatttaattcttattttttatcaaataagtcaaaattcacgagtttattactgttct |
17775650 |
T |
 |
| Q |
183 |
actcggtgaagaaaactcaaacaaaaaagtggcaaatac |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17775651 |
actcggtgaagaaaactcaaacaaaaaagtggcaaatac |
17775689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University