View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6429_low_46 (Length: 229)
Name: NF6429_low_46
Description: NF6429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6429_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 95 - 219
Target Start/End: Original strand, 33538644 - 33538764
Alignment:
| Q |
95 |
gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgctagctcattatactgttatgtagacaaataacgacataataggtgaag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33538644 |
gtgttttttctcgattgatcttttgcaacaaagattagttcaaactcttcgct----cattatactgttatgtagacaaataacgacataataggtgaag |
33538739 |
T |
 |
| Q |
195 |
aaaattagtaaggttttgatgatgt |
219 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33538740 |
aaaattagtaaggttttgatgatgt |
33538764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University