View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6431_high_13 (Length: 254)
Name: NF6431_high_13
Description: NF6431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6431_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 1153694 - 1153551
Alignment:
| Q |
1 |
aagtctagtaatctgatgctttaatgtcatattagtgtaaaaataaatgttctgcaatttggttactttgagtgccagagtctagcaatctgatgcttta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1153694 |
aagtctagtaatctgatgctttaatgtcatattagtgtaaaaataaatgttctgcaatttggttacttttagtgccagagtctagcaatctgatgcttta |
1153595 |
T |
 |
| Q |
101 |
atgttagcttgtgcatgtatgtatctgtgcataaacaatatcaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1153594 |
atgttagcttgtgcatgtatgtatctgtgcataatcaatatcaa |
1153551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 42 - 104
Target Start/End: Complemental strand, 1153730 - 1153668
Alignment:
| Q |
42 |
aataaatgttctgcaatttggttactttgagtgccagagtctagcaatctgatgctttaatgt |
104 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
1153730 |
aataaatgttttgcaatttggttactttgagtgccaaagtctagtaatctgatgctttaatgt |
1153668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 145 - 204
Target Start/End: Complemental strand, 1153758 - 1153699
Alignment:
| Q |
145 |
catattagtgtaaaaagattttggagtcagtaaatgttctgcaatctggttactttgagt |
204 |
Q |
| |
|
|||| ||||||||||||||| |||||| | |||||||| |||||| |||||||||||||| |
|
|
| T |
1153758 |
cataatagtgtaaaaagattctggagttaataaatgttttgcaatttggttactttgagt |
1153699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University