View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6431_low_11 (Length: 309)
Name: NF6431_low_11
Description: NF6431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6431_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 212 - 290
Target Start/End: Complemental strand, 8179735 - 8179654
Alignment:
| Q |
212 |
atggagtgcaagttc---atttccttgctggctgaatcttgacgagttgtagaccaagtttgctcacagttgtcgcttgttc |
290 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8179735 |
atggagtgcaagttcttcatttccttgctggctgaatcttgacgagttgtagaccaagtttgctcacagttgtcgcttgttc |
8179654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 99 - 138
Target Start/End: Complemental strand, 8195527 - 8195488
Alignment:
| Q |
99 |
aaaattgatttacggaaaagttcattctcataacgtttta |
138 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8195527 |
aaaattgatttaaggaaaagttcattctcataacgtttta |
8195488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 71
Target Start/End: Complemental strand, 8195621 - 8195579
Alignment:
| Q |
29 |
ataaatgaatttcatcaaatgtatgtgctacctgattgttttt |
71 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8195621 |
ataaatgaatttcaacaaatgtatgtgctacctaattgttttt |
8195579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University