View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6432_low_10 (Length: 202)
Name: NF6432_low_10
Description: NF6432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6432_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 186
Target Start/End: Original strand, 19430823 - 19431000
Alignment:
| Q |
10 |
acatcatcactttgtcctttatggtctgatggaatatttaaagaggaggtttgttcttctttccacttttaagtctgtttgattataaagatcatgatgt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19430823 |
acatcgtcactttgtcctttatggtctgatggaatatttaaagaggaggtttgttcttctttccacttttaagtctgtttgattataaagatcatgatgt |
19430922 |
T |
|
| Q |
110 |
g-ctgatatctatattctgatatatgatcttacaactatatatgtttcattcagttttgacagacacttcactgctga |
186 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19430923 |
gcctgatatctatattctgatatatgatcttacaactatatatgtttcattcagttttgacagacacttcactgctga |
19431000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 73; Significance: 1e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 10 - 110
Target Start/End: Complemental strand, 19491971 - 19491871
Alignment:
| Q |
10 |
acatcatcactttgtcctttatggtctgatggaatatttaaagaggaggtttgttcttctttccacttttaagtctgtttgattataaagatcatgatgt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
19491971 |
acatcgtcactttgtcctttatggtctgatggaatatctaaagaggaggtttgttcttcgttccacttttaaacatgtttgattatagagatcatgatgt |
19491872 |
T |
|
| Q |
110 |
g |
110 |
Q |
| |
|
| |
|
|
| T |
19491871 |
g |
19491871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 133 - 186
Target Start/End: Complemental strand, 19491868 - 19491815
Alignment:
| Q |
133 |
tgatcttacaactatatatgtttcattcagttttgacagacacttcactgctga |
186 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
19491868 |
tgatcttacaactatatatgcttcgttcagttttgatagacacttcactgctga |
19491815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University