View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6434_low_5 (Length: 285)
Name: NF6434_low_5
Description: NF6434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6434_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 4681341 - 4681618
Alignment:
| Q |
17 |
agaaccttgtaaagcgagaacaccaacaaccgccatattgtggag-----actgaaatgaaacaccaatgggaagaagagagggagtgtttatgtttggt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4681341 |
agaaccttgtaaagcgagaacaccaacaaccgccatattgtggagtggagagtgaaatgaaacaccaatgggaagaagagagggagtgtttatgtttggt |
4681440 |
T |
 |
| Q |
112 |
cctctcgttttg--atttcaatatgcgtgg------tattattattatactcgatt------ttttattgacgtcattgggctgctgctgcctcgtaaat |
197 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4681441 |
cctctcgttttgatatttcagtatgcgtggtgttattattattattatactccatttttttattttattgacgtcattgggctgctgctgcctcgtaaat |
4681540 |
T |
 |
| Q |
198 |
gctctcaaaattatagtattgtatagtataggttggt---tggtattagtgtcattcccattcacacatacacaggtt |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4681541 |
gctctcaaaattatagtatagtatagtataggttggttggtggtattagtgtcattcccattcacacatacacgggtt |
4681618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University