View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6437_high_13 (Length: 250)
Name: NF6437_high_13
Description: NF6437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6437_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 18631666 - 18631485
Alignment:
| Q |
19 |
aatccgagttttacaattgacacaagattttattcttttaaactaaatgaaaatagtattgttttctgctttccctgttaatttgtaattaggaaagttt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18631666 |
aatccgagttttacaattgagacaagattttattcttttaaactaaatgaaaatagtattgttttctgctttccctgt-aatttgtaattaggaaagttt |
18631568 |
T |
 |
| Q |
119 |
gaagcttcttgtattatatgaaactggatcatttcctttgcattagttaaaccttatgaagcacagatacgaacacggacacc |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18631567 |
gaagcttcttgtgttatatgaaactggatcttttcctttgcattagttaaaccctatgaagcacagatacgaacacggacacc |
18631485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University