View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6437_low_14 (Length: 236)
Name: NF6437_low_14
Description: NF6437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6437_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 28816502 - 28816285
Alignment:
| Q |
1 |
aaattttgtagtagttttattttgctttcatactttgtttttattgtaataacacttctacagttagattggtcaaacatggatggaagactgaggtttt |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28816502 |
aaattttgtagtggttttattttgctttcatactttgtttttattgtaataacacttctacagttagattggtcaaacatggatggaagactgaggtttt |
28816403 |
T |
|
| Q |
101 |
tcttaaccagaagttaggcatgggaggagtgtcttgcactcagctgtaaagtgtaaagccagtgaatgtaactgttgtcatttgtaaccacagcaagaat |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28816402 |
tcttaaccagaagttaggcatg---ggagtgtcttgcactcagctgtaaagtgtaaagccagtgaatgtaactgttgtcatttgtaaccacagcaagaat |
28816306 |
T |
|
| Q |
201 |
agtcatagtatatgttagaaa |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
28816305 |
agtcatagtgtatgttagaaa |
28816285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University