View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6437_low_15 (Length: 233)

Name: NF6437_low_15
Description: NF6437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6437_low_15
NF6437_low_15
[»] chr4 (1 HSPs)
chr4 (18-218)||(8187955-8188155)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 8187955 - 8188155
Alignment:
18 tctttgacacgagagcagcacaaattccatcagtaattcatattagaacaagtatatatcagtaggttcagacgttcagttcccaattcaatcggttgaa 117  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||    
8187955 tctttaacacgagagcagcacaaattccatcagtaattcatattagagcaagtatttatcagtaggttcagacgttcagttcccaattcaatcggttgaa 8188054  T
118 cacgccggtctggtccagttttgattacattgtgaatgaatnnnnnnntactttcaaagtgaaaaatattgtatgtcacttctttcctggggagttctct 217  Q
    |||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||| ||||| |||| | ||||||    
8188055 cacgccggtctggtccagttttgattacattgtgaatgaataaaaaaatactttcaaagtgaaaaatattgtatgtcactactttcttgggaatttctct 8188154  T
218 g 218  Q
    |    
8188155 g 8188155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University