View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6439_high_3 (Length: 263)
Name: NF6439_high_3
Description: NF6439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6439_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 11 - 254
Target Start/End: Complemental strand, 21583910 - 21583667
Alignment:
| Q |
11 |
aattagatggtggtgggaaggtggttgaagaggtggagggtgctagtaaggggtatgtcccaaagtatttttccacagaacctgatgtagcatgggctag |
110 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21583910 |
aattagatggtggtgggaaggtggctgtagaggtgaagggtgctaataaggggtatgtcccaaagtatttttccacagaacatgatgtagcatgggctag |
21583811 |
T |
|
| Q |
111 |
tcgaggtgttgtggtatcagagttgaacgaagatgctattccgatgtttcaacgttggatttttgacgcagggtttgataaactgaatattattccgctg |
210 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||||||||||| || |||||||| |||||||||| |||||||||||||||||||||||||| ||| || |
|
|
| T |
21583810 |
tcgaggtgtggtggtatcagtgttgaacggagatgctattccagtggttcaacgtcggatttttgatgcagggtttgataaactgaatattataccgttg |
21583711 |
T |
|
| Q |
211 |
ggttcagataaagtgttcttaacaacagataacgatgatgatgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21583710 |
ggttcagataaagtgttcttaacaacagataacgatgaggatgt |
21583667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University