View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6439_low_9 (Length: 207)

Name: NF6439_low_9
Description: NF6439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6439_low_9
NF6439_low_9
[»] chr3 (1 HSPs)
chr3 (1-207)||(50042279-50042485)


Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 50042485 - 50042279
Alignment:
1 aagatctatgcgccctaagagaggatgacgagttatatatcatctaatcttcgcaccaaatagagacaattacaatcttgttatctaaacatgatatgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50042485 aagatctatgcgccctaagagaggatgacgagttatatatcatctaatcttcgcaccaaatagagacaattacaatcttgttatctaaacatgatatgat 50042386  T
101 tgcaatgtataaagtaagaaaaacatgcatggaattttgaaatatgtggaaataaaattcttagcatattaaaatgaaaaaggatcgaataatattaccc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50042385 tgcaatgtataaagtaagaaaaacatgcatggaattttgaaatatgtggaaataaaattcttagcatattaaaatgaaaaaggatcgaataatattaccc 50042286  T
201 taaggct 207  Q
    |||||||    
50042285 taaggct 50042279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University