View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6440_high_11 (Length: 214)
Name: NF6440_high_11
Description: NF6440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6440_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 6984192 - 6984013
Alignment:
| Q |
18 |
cgaacctctaggacattgagaaagtggtgagtgaggagtgattgtaggccgtgtttggagagggtgtgaacgtgagaaacaaattgatgagtagtgaatg |
117 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6984192 |
cgaacctctaagactttgagaaagtggggagtgaggagtgattgtaggccgtgtttgcagagggtgtgaacgtgagaaacaaattgatgagtagtgaatg |
6984093 |
T |
|
| Q |
118 |
agaggtgatcgtggagaagaagagattgtgtggcgttgcagaatgcgttgtagctttcaaggatttcgttaacttcatct |
197 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6984092 |
agatgtgatcgtggagaagaagagattgtgtggcgttgcagaaggcgttgtagctttcaatgatttcgttaacttcatct |
6984013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University