View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6440_high_13 (Length: 212)

Name: NF6440_high_13
Description: NF6440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6440_high_13
NF6440_high_13
[»] chr5 (1 HSPs)
chr5 (17-196)||(29726611-29726790)


Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 29726790 - 29726611
Alignment:
17 atggtgatgttgtgttatagttggggaataaaggttctaactgtttttgcattctcaaccaataattggattcgacctaaggtcattttaatttcacttg 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
29726790 atggtgatgttgtgttatagttggggaataaaggttctaactgtttttgcattctcaaccgataattggattcgacctaaggtcattttaatttcacttg 29726691  T
117 ttagtttagttcactttgattaacatgacattagttgttgatagtggttatgcttggttttgattattggtggtgatgat 196  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||    
29726690 ttagtttagttcactttgatgaacatgacattagttgttgatagtggttatgcttggttttcattattggtggtggtgat 29726611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University