View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6440_low_3 (Length: 463)
Name: NF6440_low_3
Description: NF6440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6440_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 10 - 447
Target Start/End: Complemental strand, 33247858 - 33247420
Alignment:
| Q |
10 |
attatactcttgagttcaatcaccttgttgccaaattcaaatttgcaacattaccccaatttttctagcataatcaactttttatttttcaaaaagggtc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33247858 |
attatactcttgagttcaatcaccttgttgccaaattcaaatttgcaacgttaccccaatttttctaacataatcaactttttatttttcaaaaagggtc |
33247759 |
T |
 |
| Q |
110 |
agtagtgttcacaacggtatagtgtaatgtttgcattgcataaaacaagaacgaagagattttgattctcgagt---------aataacgacccttgccc |
200 |
Q |
| |
|
||| ||||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33247758 |
agt---gttcataacggtatagtgtaatgagt----tgcataaaacaagaacgaagagattttgattctcgagttgatcacctaataacgacccttgccc |
33247666 |
T |
 |
| Q |
201 |
ccatcttccactgaaattttgacaagttacaagtatgctctactattattactattcaaaatgaggacaaattgttggctataaatttcaagtgaccctt |
300 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33247665 |
c-atcttccactgaaattttgacaagttacaagtatgctctactattattactattcaaaatgaggacaaattgttggctataaatttcaagtgaccctt |
33247567 |
T |
 |
| Q |
301 |
ttcaataggacaatagtaggatagctttaaacaaataacaaaatgaaaatattaccttgatactattattttgcgggaatggagcgtggcagggaaagga |
400 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33247566 |
ttcaataggacaataataggatagctttaaacaaataacaaaatgaaaatattaccttgatactattattttgcgggaatggagcgtggcagggaaagga |
33247467 |
T |
 |
| Q |
401 |
attaaacttcataaggacgcaatggtcccctaacttgcttccaaact |
447 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33247466 |
attaaacttcataaggacgcaatggtcccctaacttgcttccaaact |
33247420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University