View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6441_high_10 (Length: 279)
Name: NF6441_high_10
Description: NF6441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6441_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 14 - 141
Target Start/End: Complemental strand, 51170350 - 51170223
Alignment:
| Q |
14 |
gaagtaccatcaaaagaaaagtaaactccaatagatgcaagttgaattcaataatttgaaaacccgaataaattgggatcccacaacgttctaatgtagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51170350 |
gaagtaccatcaaaagaaaagtaaactccaatagatgcaagttgaattcaataatttgaaaacccgaataaattgggatcccacaacgttctaatgtagt |
51170251 |
T |
|
| Q |
114 |
tattttcatgtttgattttctgcaagtg |
141 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51170250 |
tattttcatgtttgattttctgcaagtg |
51170223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 219 - 263
Target Start/End: Complemental strand, 51169965 - 51169917
Alignment:
| Q |
219 |
gggtggttttagaacattactac----cttttatcataggtaatgaatg |
263 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51169965 |
gggtggttttagaacattactacgtaccttttatcataggtaatgaatg |
51169917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 149 - 178
Target Start/End: Complemental strand, 51170022 - 51169993
Alignment:
| Q |
149 |
cactcttctaagccagaagcataacaccaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
51170022 |
cactcttctaagccagaagcataacaccaa |
51169993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University