View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6442_high_10 (Length: 249)
Name: NF6442_high_10
Description: NF6442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6442_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 3 - 247
Target Start/End: Complemental strand, 43129476 - 43129232
Alignment:
| Q |
3 |
gagtgagaagaacaatccttcaatgaaaactgctgcgagtgcgctttggtaggagatagtgccggaaccgtgaaagcccacgacggtgtaagcgaagtaa |
102 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129476 |
gagtaagaagaacattccttcaatgaaaactgctgcgagtgcgctttggtaggagatagtgccggaaccgtgaaagcccacgacggtgtaagcgaagtaa |
43129377 |
T |
 |
| Q |
103 |
gcgtttgagcccatacctggagcaaggcctaatgggagattagcaaaagcacccatgatgaagcaaccaatgagggaagaagccacggttgcgacgatca |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129376 |
gcgtttgagcccatacctggagcaaggcctaatgggagattagcaaaagcacccatgatgaagcaaccaatgagggaagaagccacggttgcgacgatca |
43129277 |
T |
 |
| Q |
203 |
agtcttttcgggttttatcaagacaagcggcgtagcccgggttaa |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129276 |
agtcttttcgggttttatcaagacaagcggcgtagcccgggttaa |
43129232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University