View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6442_low_8 (Length: 320)
Name: NF6442_low_8
Description: NF6442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6442_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 20 - 313
Target Start/End: Original strand, 43128905 - 43129198
Alignment:
| Q |
20 |
aaaggcccccacttccagcccaccaagcccacacaaaacccatctctcgtttcaactcctatgtggcgaaaactagagtaggaaaatatttcaaactctc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43128905 |
aaaggcccccacttccagcccaccaagcccacacaaaacccatctctcgtttcaactcctatgtggcgaaaactagagtaggaaaatattttaaactctc |
43129004 |
T |
|
| Q |
120 |
ccaacgtaactccactttcaccactgaactccgtgccggaaccgccactttcctcaccatggcttacatcctcgccgtcaacgcctccattctaactgat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129005 |
ccaacgtaactccactttcaccactgaactccgtgccggaaccgccactttcctcaccatggcttacatcctcgccgtcaacgcctccattctaactgat |
43129104 |
T |
|
| Q |
220 |
tccggcggcacatgctctgtttccgattgtgttcctctctgttcaaacccatccttctctacctcaaactgtaccggcccatcatttcatctca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43129105 |
tccggcggcacatgctctgtttccgattgtgttcctctctgttcaaacccatccatctctacctcaaactgtaccggcccatcatttcatctca |
43129198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 217
Target Start/End: Original strand, 34139198 - 34139270
Alignment:
| Q |
145 |
gaactccgtgccggaaccgccactttcctcaccatggcttacatcctcgccgtcaacgcctccattctaactg |
217 |
Q |
| |
|
||||| ||||||| ||| |||||||| || ||||||||||||||| | |||||||||| |||| ||||||| |
|
|
| T |
34139198 |
gaactacgtgccgcaacagccacttttctaaccatggcttacatcataaccgtcaacgcaaccatcctaactg |
34139270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University