View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6444_low_3 (Length: 307)
Name: NF6444_low_3
Description: NF6444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6444_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 282
Target Start/End: Original strand, 38829615 - 38829885
Alignment:
| Q |
12 |
atgagatgaagctgaaggatttgaaagctcagaattacttgtttcagtcaattgacaagtcaattctgaagaccatcacgcagaaggagacatctaaaca |
111 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
38829615 |
atgacatgaagctgaaggatttgaaggctaagaattacttgtttcagttaattgacaagtcaattctgaagacgaacacgcagaaggagacatctaaacg |
38829714 |
T |
 |
| Q |
112 |
gctatgggattccatgaagttgaagtgtcgcggcaatgctcgagtgaagagagcacagcttaatcgtctacgccgagactttgaggtcttagcaatgaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38829715 |
gctatgggattccatgaagttgaagtgtcgcgacaatgctcgagtgaagagagcacaactcaatcatctacgccgagactttgaggtcttagcaatgaag |
38829814 |
T |
 |
| Q |
212 |
cagggtgaatcgatcattgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
282 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38829815 |
cagggtgaatcaatcactgattattttggtcgagtaatgacggttgcaaacgacatgaggaattatgggga |
38829885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University