View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6445_low_1 (Length: 297)
Name: NF6445_low_1
Description: NF6445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6445_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 69 - 292
Target Start/End: Original strand, 33857886 - 33858110
Alignment:
| Q |
69 |
atgcatatagactaagaatagatacctaagcatgttatgcagtttttggtttgactaaatgacacttgatgcgagcgattctagctttatatcttgtaca |
168 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33857886 |
atgcatatagactaagattagatacctaagcatgttatgcagtttttggtttgactaaatgacacttaatgcgagcgattctagctttatatcttgtaca |
33857985 |
T |
 |
| Q |
169 |
attttttggttctctcctttgaagcctgctgtagtatcttagcatgaaactttatagattccaattcatattatctt-actggatgactactttcccgtg |
267 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||| | || |
|
|
| T |
33857986 |
attttttggttctctcctttgcagcctgctgtagtatcttagcatgaaactttatagattccaattcatatgctcttgactggataactactttctcatg |
33858085 |
T |
 |
| Q |
268 |
aagaactgatacatatgatgatgtc |
292 |
Q |
| |
|
||||||||||| ||| ||||||||| |
|
|
| T |
33858086 |
aagaactgatatatacgatgatgtc |
33858110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 74 - 135
Target Start/End: Original strand, 33420886 - 33420947
Alignment:
| Q |
74 |
tatagactaagaatagatacctaagcatgttatgcagtttttggtttgactaaatgacactt |
135 |
Q |
| |
|
|||||||||||| ||||| ||||||||| |||||||||||||||||||| ||||| ||||| |
|
|
| T |
33420886 |
tatagactaagattagatgcctaagcatagtatgcagtttttggtttgaccaaatgccactt |
33420947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University