View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6446_low_7 (Length: 325)
Name: NF6446_low_7
Description: NF6446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6446_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 135 - 312
Target Start/End: Original strand, 23174873 - 23175050
Alignment:
| Q |
135 |
attttaattgggtaatccagttactgattttttctttctacaatgtgataaacagttaaacacacccgttcttgttatggatttggaccctcgagtcttt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23174873 |
attttaattgggtaatccagttactgattttttctttctacaatgtgataaacagttaaacacacccgttcttgttatggatttggaccctcgagtcttt |
23174972 |
T |
 |
| Q |
235 |
gcctctctgtgtactgcttagttcacttcctatcggtatttgatttaccagtaagatcaaatatcaaaacatttccct |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23174973 |
gcctctctgtgtactgcttagttcacttcctatcggtatttgatttactagtaagatcaaatatcaaaacatttccct |
23175050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 302
Target Start/End: Original strand, 13983642 - 13983735
Alignment:
| Q |
209 |
ttatggatttggaccctcgagtctttgcctctctgtgtactgcttagttcacttcctatcggtatttgatttaccagtaagatcaaatatcaaa |
302 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| ||| ||| | || ||||||||||| ||| | || || |||||| ||||||||||| |
|
|
| T |
13983642 |
ttatggatttggacccttaagtctttgcctatctgtcaactacttggatcgattcctatcggtttttcaatttccggtaagaacaaatatcaaa |
13983735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University