View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6447_high_29 (Length: 243)

Name: NF6447_high_29
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6447_high_29
NF6447_high_29
[»] chr5 (2 HSPs)
chr5 (29-104)||(38320499-38320574)
chr5 (147-225)||(38320419-38320497)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 38320574 - 38320499
Alignment:
29 ttgtcttgtagttcaacctttttgtgacttagacccttatcatagtccttgtttgagcttcatatgattgttagta 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38320574 ttgtcttgtagttcaacctttttgtgacttagacccttatcatagtccttgtttgagcttcatatgattgttagta 38320499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 147 - 225
Target Start/End: Complemental strand, 38320497 - 38320419
Alignment:
147 cctctaagcgcttcactatttgtttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggatacaatga 225  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
38320497 cctctaagcgcttcactatttgcttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggacacaatga 38320419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University