View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_high_29 (Length: 243)
Name: NF6447_high_29
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_high_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 38320574 - 38320499
Alignment:
| Q |
29 |
ttgtcttgtagttcaacctttttgtgacttagacccttatcatagtccttgtttgagcttcatatgattgttagta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38320574 |
ttgtcttgtagttcaacctttttgtgacttagacccttatcatagtccttgtttgagcttcatatgattgttagta |
38320499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 147 - 225
Target Start/End: Complemental strand, 38320497 - 38320419
Alignment:
| Q |
147 |
cctctaagcgcttcactatttgtttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggatacaatga |
225 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38320497 |
cctctaagcgcttcactatttgcttggacgatatttgttaaggatgcgaccaattttggttgcttgcgggacacaatga |
38320419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University