View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_high_30 (Length: 242)
Name: NF6447_high_30
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 173
Target Start/End: Complemental strand, 52591883 - 52591842
Alignment:
| Q |
132 |
aatatggttaacaattataccaacaattgatttaaacacaaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52591883 |
aatatggttaacaattataccaacaattgatttaaatacaaa |
52591842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University