View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_low_18 (Length: 301)
Name: NF6447_low_18
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 6559714 - 6559865
Alignment:
| Q |
18 |
ggtattgtagtcttttaagtgataatgtgtttatgatttttgtgttatacgnnnnnnnattcatgttgaaattgttatgtgttcagatgaacaaatgcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6559714 |
ggtattgtagtcttttaagtgataatgtgtttatgatttttgtgttatacgtttttttattcatgttgaaattgttatgtgttcagatgaacaaatgcca |
6559813 |
T |
 |
| Q |
118 |
tccatattaattcagtaagattttcttccaaattaatttgttctactattca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6559814 |
tccatattaattcagtaagattttcttccaaattaatttgttctactattca |
6559865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 258 - 293
Target Start/End: Original strand, 6559955 - 6559990
Alignment:
| Q |
258 |
caagaatatcatgatagggtacattgaattcctatg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6559955 |
caagaatatcatgatagggtacattgaattcctatg |
6559990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University