View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_low_20 (Length: 279)
Name: NF6447_low_20
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 17 - 276
Target Start/End: Original strand, 36076104 - 36076363
Alignment:
| Q |
17 |
agaagggattattggaatgtggaagaaagtgcactccatcacccttcttgttgaagacatacatgttggttgaggatccgataaccgatggtgtgatatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36076104 |
agaagggattattggaatgtggaagaaagtgcactccatcacccttcttgttgaagacatacatgttggttgaggatccgataaccgatggtgtgatatc |
36076203 |
T |
 |
| Q |
117 |
gtggaacgatgaaggaacggcatttgtggtgtggcagccggcggagtttgctcgtgatatccttccaacactcttcaagcatagcaacttctctagcttt |
216 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36076204 |
gtggaacgatgaaggaacggcgtttgtggtgtggcagccggcggagtttgctcgtgatatccttccaacactcttcaagcatagcaacttctctagcttt |
36076303 |
T |
 |
| Q |
217 |
gtacggcagctcaatacttatgtacgtacatacatctaaatctatgctttgtttatagat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36076304 |
gtacggcagctcaatacttatgtacgtacatacatctaaatctatgctttgtttatagat |
36076363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University