View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_low_23 (Length: 256)
Name: NF6447_low_23
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 163
Target Start/End: Original strand, 8404517 - 8404665
Alignment:
| Q |
17 |
aaaagcgtgttccaattgtcacgttgctgtcctaagtttttatgcatttcaattctgtctgatacagcctccgaaatcgc--agagttttatagtagtaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
8404517 |
aaaagcgtgttccaattgtcacgttgttgtcctaagtttttatgcatttcaattctgtctgatacagcctccgaaattgcatagagttttatagtagtaa |
8404616 |
T |
|
| Q |
115 |
tattaaattttgaagaattatatatactttcatcataatcaccatgatc |
163 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404617 |
tattaaaatttgaagaattatatatactttcatcataatcaccatgatc |
8404665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University