View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_low_37 (Length: 238)
Name: NF6447_low_37
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 71 - 220
Target Start/End: Complemental strand, 7721309 - 7721160
Alignment:
| Q |
71 |
cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721309 |
cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt |
7721210 |
T |
 |
| Q |
171 |
gcaagtatagagttgttttgtctttaccacttgttttgcgagtagcgggt |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7721209 |
gcaagtatagagttgttttgtctttgccacttgttttgcgagtagcgggt |
7721160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University