View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6447_low_37 (Length: 238)

Name: NF6447_low_37
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6447_low_37
NF6447_low_37
[»] chr2 (1 HSPs)
chr2 (71-220)||(7721160-7721309)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 71 - 220
Target Start/End: Complemental strand, 7721309 - 7721160
Alignment:
71 cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7721309 cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt 7721210  T
171 gcaagtatagagttgttttgtctttaccacttgttttgcgagtagcgggt 220  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||    
7721209 gcaagtatagagttgttttgtctttgccacttgttttgcgagtagcgggt 7721160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University