View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6447_low_38 (Length: 238)
Name: NF6447_low_38
Description: NF6447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6447_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 601996 - 601777
Alignment:
| Q |
17 |
ccatagatttcctccacttgatgtgatcttattagagctaggttggacattaaatttgtgtacctcttcgattatga--------------gtctaggtc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
601996 |
ccatagatttcctccacttgatgtgatcttattagagctgggttggacattaaatttgtgtacctcttggattatgaatcacgtattacgagtctaggtc |
601897 |
T |
 |
| Q |
103 |
cttccactatatacccaacgattttggtcttcaacatatcaattgatcatttataaaagagataatgcaaccatatatcttttccaaaaactaattttat |
202 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
601896 |
cttccactatatactcaaccattttggtcttcaacatatcaattgatcatttataaaagagataatgcaaccatatatcttttccaaaagctaattttat |
601797 |
T |
 |
| Q |
203 |
gacataaaatcggtatgtta |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
601796 |
gacataaaatcggtatgtta |
601777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 804687 - 804642
Alignment:
| Q |
150 |
catttataaaagagataatgcaaccatatatcttttccaaaaacta |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
804687 |
catttataaaagagataatgcaaccatatatcttttccaaaaacta |
804642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University