View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6448_high_2 (Length: 240)
Name: NF6448_high_2
Description: NF6448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6448_high_2 |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 23 - 198
Target Start/End: Complemental strand, 7329494 - 7329323
Alignment:
| Q |
23 |
atgtgtcattacaaagatataccaaaaatggaatagtgtataattcaatataaaaacataaatgttcaattgtgatatgaaaagatctattgtagctctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7329494 |
atgtgtcattacaaagatataccaaaaatggaatagtgtataattcaatataaaaacataaatgttcaattgtgatatgaaaagatctattgtagctctt |
7329395 |
T |
 |
| Q |
123 |
acttggttagtattagtgttgcattaaccgatgnnnnnnnnnngacacgacactcttaaagtcataacttgtcatt |
198 |
Q |
| |
|
| |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7329394 |
aggtggttagtattagtgtagcattaaccgatg----aaaaaagacacgacactcttaaagtcataacttgtcatt |
7329323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 78 - 121
Target Start/End: Complemental strand, 6221 - 6178
Alignment:
| Q |
78 |
acataaatgttcaattgtgatatgaaaagatctattgtagctct |
121 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
6221 |
acataaatgttcaattttgataataaaagatctattgtagctct |
6178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University