View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6449_high_11 (Length: 253)
Name: NF6449_high_11
Description: NF6449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6449_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 30238599 - 30238835
Alignment:
| Q |
1 |
aagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgttacacttgagtgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238599 |
aagaaatcaattgatgaagtttcaaaggaaaacaagagttacctcttcagtgacacttggtaataataatgttcaaagaagcgttacacttgagtgttgc |
30238698 |
T |
 |
| Q |
101 |
tctttgtcatgtattgtnnnnnnnctattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccacagtatagctatgatc |
200 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238699 |
tctttgtcatttattgtaaaaaaactattttgtaagttgaagaattgttggaaacaatctcttgggtggaaaaggagcagtccacagtatagctatgatc |
30238798 |
T |
 |
| Q |
201 |
ttcaaagctattgtctcaactttgatgatggcacttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30238799 |
ttcaaagctattgtctcaactttgatgatggcacttc |
30238835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 222
Target Start/End: Complemental strand, 39325356 - 39325312
Alignment:
| Q |
178 |
cagtccacagtatagctatgatcttcaaagctattgtctcaactt |
222 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
39325356 |
cagtccacagtatagctatgatcttcgcagttattgtctgaactt |
39325312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University