View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6449_low_10 (Length: 253)
Name: NF6449_low_10
Description: NF6449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6449_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 20 - 243
Target Start/End: Complemental strand, 43131352 - 43131129
Alignment:
| Q |
20 |
gtttgttcctctccatcaacagcttgaaatgtgaatttatatggtttgccacttctgctgatgcttgagtcgcctttgattgcagctcaggaatctttga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43131352 |
gtttgttcctctccatcaacagcttgaaatgtgaatttatatggtttgccacttctgctgatgcttgagtcgcctttgattgcagctcaggaatctttga |
43131253 |
T |
 |
| Q |
120 |
tgtcatggatttactatacaaaattatattaagatatataaggttcaaaaatttattcaaatctcatcattctgtttttcttttaaatttccacacacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43131252 |
tgtcatggatttactatacaaaattatattaagatatatatgggtcaaaaatttattcaaatctcatcattctgtttttcttttaaatttccacacacaa |
43131153 |
T |
 |
| Q |
220 |
accttgctgtatgagtcacctttg |
243 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
43131152 |
accttgttgtatgagtcacctttg |
43131129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 81 - 142
Target Start/End: Complemental strand, 43130508 - 43130447
Alignment:
| Q |
81 |
tgcttgagtcgcctttgattgcagctcaggaatctttgatgtcatggatttactatacaaaa |
142 |
Q |
| |
|
|||||||||| ||||| ||||||||| |||||||||||| ||||| || ||||||||||| |
|
|
| T |
43130508 |
tgcttgagtcacctttaattgcagctgaggaatctttgaagtcattagttcactatacaaaa |
43130447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University