View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6449_low_9 (Length: 256)
Name: NF6449_low_9
Description: NF6449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6449_low_9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 71 - 256
Target Start/End: Complemental strand, 11378678 - 11378494
Alignment:
| Q |
71 |
tttttgtatagagaaaagagtgaaagttatgttagaagagcaaacagtaa-gatggcaaatctaaatccaatcaacgaagaaaatgaaaaaagtgaggca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11378678 |
tttttgtatagagaaaagagtgaaagttatgttagaagagcaaacagtaaagatggcaaatctaaatccaatcaatgaagaaaatgaaaa--gtgaggca |
11378581 |
T |
|
| Q |
170 |
gcgagaaaaagagaaacgaacactagatagattggagaatgaatttcctcactcaactgctcagtttttatagcactggtttcgttg |
256 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
11378580 |
gcgagaaaaagagaaacgaaccctagatagattggtgaatgaatttcctcactccactgctccgtttttatagcactggtttggttg |
11378494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University